Skip to main content

Table 1 Primers and probes used in qPCR assays

From: Quantitative PCR of ear discharge from Indigenous Australian children with acute otitis media with perforation supports a role for Alloiococcus otitidis as a secondary pathogen

Assay Gene Primer and Probe sequences Position Amplicon size (bp) Reference
Ao 16S rRNA Forward primer 5'- CTACGCATTTCACCGCTACAC -3' 437-457 265 [33]
Reverse primer 5'- GGGGAAGAACACGGATAGGA -3' 702-483
TBL 16S rRNA Forward primer 5'- TCCTACGGGAGGCAGCAGT -3' 331-349 466 [6, 36]
Reverse primer 5'- GGACTACCAGGGTATCTAATCCTGTT -3' 797-772
Hi hpd Forward primer 5’- GGTTAAATATGCCGATGGTGTTG -3’ 822-844 151 [37, 38]
Reverse primer 5’- TGCATCTTTACGCACGGTGTA -3’ 972-953
Probe 5’Hex- TTGTGTACACTCCGT “T” GGTAAAAGAACTTGCAC -SpC6 -3’* 928-896
Spn lytA Forward primer 5'- TCTTACGCAATCTAGCAGATGAAGC -3' 306-326 101 [6]
Reverse primer 5'- GTTGTTTGGTTGGTTATTCGTGC -3' 406-386
Probe 5'- [6-FAM]-TTTGCCGAAAACGCTTGATACAGGG -[TAMRA] -3' 354-330
Mc copB Forward primer 5'- GTGAGTGCCGCTTTTACAACC -3' 50-70 72 [6]
Reverse primer 5'- TGTATCGCCTGCCAAGACAA -3' 121-102
  1. Ao = A. otitidis. TBL = Total bacterial load. Spn = S. pneumoniae. Hi = H. influenzae. Mc = M. catarrhalis. 16S rRNA gene position numbers are based on E. coli numbering. * Inverted commas in the primer sequence of the hpd probe indicate the position of the Black Hole Quencher.